Trichophyton rubrum (Castellani) Sabouraud
28191 ™
An ampoule containing viable cells (yeast cells, spores, or agar cubes with mycelia) suspended in cryoprotectant.
Product category
Fungi
Strain designation
689
Type strain
No
Product format
Frozen
Storage conditions
-80°C or colder
Morphology
Colonies on Emmons' modification of Sabouraud's agar at 25°C fluffy to cottony, white becoming rose when ageing; reverse wine-red to olive. Microconidia peg-shaped to pyriform, sessile alongside undifferentiated hyphae.
Handling information
Medium
ATCC Medium 28: Emmons' modification of Sabouraud's agar/broth
ATCC Medium 200: YM agar or YM broth
Temperature
24-26°C
Atmosphere
Aerobic
Handling procedure
Frozen ampoules packed in dry ice should either be thawed immediately or stored in liquid nitrogen. If liquid nitrogen storage facilities are not available, frozen ampoules may be stored at or below -70°C for approximately one week. Do not under any circumstance store frozen ampoules at refrigerator freezer temperatures (generally -20°C). Storage of frozen material at this temperature will result in the death of the culture.
To thaw a frozen ampoule, place in a 25°C to 30°C water bath, until just thawed (approximately 5 minutes). Immerse the ampoule just sufficient to cover the frozen material. Do not agitate the ampoule.
Immediately after thawing, wipe down ampoule with 70% ethanol and aseptically transfer at least 50 µL (or 2-3 agar cubes) of the content onto a plate or broth with medium recommended.
Incubate the inoculum/strain at the temperature and conditions recommended.
Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 3-4 days of incubation. However, the time necessary for significant growth will vary from strain to strain
Handling notes
Additional, updated information on this product may be available on the ATCC® web site at www.atcc.org.
Quality control specifications
Sequenced data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGACCGACGTTCCATCAGGGGTGAGCAGACGTGCGCCGGCCGTACGCCCCCATTCTTGTCTACCTCACCCGGTTGCCTCGGCGGGCCGCGCTCCCCCTGCCAGGGAGAGCCGTCCGGCGGGCCCCTTCTGGGAGCCTCGAGCCGGACCGCGCCCGCCGGAGGACAGACACCAAGAAAAAATTCTCTGAAGAGCTGTCAGTCTGAGCGTTTAGCAAGCACAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCCCCTCCCTTCGGGGGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAGCCAATTCAGCGCCCTCAGGACCGGCCGCCCTGGCCCCAATCTTTATATATATATATATCTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA
D1D2 region of the 28S ribosomal RNA gene
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGCGGCCCCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGCCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGGCGGGGTTCAGCGGGCGCTCGTCGCCCGTGCACTGCCCGCTCCCCGGGCCAGCATCAGCTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTAGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGAGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC
ATCC28191
