Aspergillus niger van Tieghem拉丁名
ATCC 64973 ATCC編號
An ampoule containing viable cells(may include spores and mycelia)suspended in cryoprotectant.
Product category Fungi
Strain designation N593
Type strain No
Isolation source
Mutant derived from ATCC 64974
Product format Frozen
Specific applications
transformation host
PreceptrolNo
Ploidy
Haploid
Genotype
cspA pyrA6
Medium
ATCC Medium 307:Cornmeal agar
Temperature 30°C
Incubation
Protocol:plus uridine
Handling procedure
Frozen ampoules packed in dry ice should either be thawed immediately or stored in liquid nitrogen.If liquid nitrogen storage facilities are not available,frozen ampoules may be stored at or below-70°C for approximately one week.Do not under any circumstance store frozen ampoules at refrigerator freezer temperatures(generally-20°C).Storage of frozen material at this temperature will result in the death of the culture.
1.To thaw a frozen ampoule,place in a 25?30°C water bath,until just thawed(approximately 5 minutes).Immerse the ampoule just sufficient to cover the frozen material.Do not agitate the ampoule.
2.Immediately after thawing,wipe down ampoule with 70%ethanol and aseptically transfer 10 microliter(or any amount desired up to all)of the content onto a plate or broth with medium recommended.
3.Incubate the inoculum/strain at the temperature and conditions recommended.
4.Inspect for growth of the inoculum/strain regularly.The sign of viability is noticeable typically after 1-2 days of incubation.However,the time necessary for significant growth will vary from strain to strain.
Handling notes
Transformation host.
Additional,updated information on this product may be available on the ATCC web site at www.atcc.org.
Sequenced data
18S ribosomal RNA gene,partial sequence;internal transcribed spacer 1,5.8S ribosomal RNA gene,and internal transcribed spacer 2,complete sequence;and 28S ribosomal RNA gene,partial sequence.
TGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAT
History
Deposited as
Aspergillus niger van Tieghem,anamorph
Synonyms
Aspergillus niger mut.cinnamomeus(Schiemann)Thom et Raper Aspergillus niger mut.schiemanni Aspergillus niger var.altipes SchiemannAspergillus cinnamomeus Schiemann,~
Depositors
CJ Bos
Cross references
GenBank GU256750 ITS including 5.8S rRNA gene
