Quantitative Synthetic DNA from Cyclospora cayetanensis 拉丁名
PRA-3000SD 編號(hào)
Quantitative Synthetic DNA from Cyclospora cayetanensis can be used for assay development, verification, and validation as well as monitoring of day-to-day test variation and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine protozoan load and for other molecular biology applications. Preparation includes the full 18S rRNA gene sequence, and full ITS1 and ITS2 sequences.
Product categoryProtists
Product typeNucleic acid
Molecular standard
OrganismCyclospora cayetanensis
ApplicationsAssay development
Enteric disease research
Infectious disease research
Next-generation sequencing
Specification range≥ 1 x 105 to 1 x 106 copies/μLVolume100 μLProduct formatFrozenShipping informationShipped in a proprietary stabilization matrix
Storage conditions-20°C or colder
Specific applicationsATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine protozoan load and for other molecular biology applications.
Genetic targetPreparation includes the full 18S rRNA gene sequence, and full ITS1 and ITS2 sequences.CommentsManufactured under ISO 13485 guidance
Handling procedureThaw the vial at room temperature and immediately place on ice. Avoid exposing the synthetic DNA to repeated freeze-thaw cycles as it may result in degradation of the DNA and variation in copy number.
Gently mix the sample to ensure an even distribution of material.
Briefly centrifuge the tube before opening to ensure all liquid is at the bottom.
Handling notesAliquotting is highly recommended to avoid multiple freeze-thaws
The following primers and probe can be used with this nucleic acid preparation Ref:
Forward primer: TGAACTCATTGGACTGACCAGC
Reverse primer: ACTTTTGCATCCTTTAGAGGGCT
Probe: FAM-CAACTTTCCGACCAGCTCCGCGAA-BHQ1
Quality accreditationManufactured under ISO 13485 guidance