>美國(guó)ATCC>ATCC菌種類>CDC B-3325*
Trichophyton tonsurans Malmsten
28942 ™
Download Genome
Learn about the ATCC Genome Portal
An ampoule containing viable cells (may include spores and mycelia) suspended in cryoprotectant.
Product category
Fungi
Type strain
No
Genome sequenced strain
Yes
Isolation source
Man
Geographical isolation
England
Product format
Frozen
Storage conditions
-80°C or colder
Specific applications
Biomedical Research and Development Material
Preceptrol
No
Characteristics
Morphology
On PDY medium at 25°C after 11 days, mycelium creamy white to pale yellow, velutinous. Reverse bright yellow to orange. Hyphae hyaline, guttulate. Conidia hyaline, ellipsoidal to clavate, smooth, 6-9 X 2.5-4 µm. Chlamydospores subglobose, 15-16.5 X 7.5-10.5 µm.
Handling information
Medium
ATCC Medium 28: Emmons' modification of Sabouraud's agar/broth
ATCC Medium 200: YM agar or YM broth
ATCC Medium 337: Potato, dextrose, yeast agar (PDY)
Temperature
24-26°C
Atmosphere
Aerobic
Handling procedure
Frozen ampoules packed in dry ice should either be thawed immediately or stored in liquid nitrogen. If liquid nitrogen storage facilities are not available, frozen ampoules may be stored at or below -70°C for approximately one week. Do not under any circumstance store frozen ampoules at refrigerator freezer temperatures (generally -20°C). Storage of frozen material at this temperature will result in the death of the culture.
To thaw a frozen ampoule, place in a 25°C to 30°C water bath, until just thawed (approximately 5 minutes). Immerse the ampoule just sufficient to cover the frozen material. Do not agitate the ampoule.
Immediately after thawing, wipe down ampoule with 70% ethanol and aseptically transfer at least 50 µL (or 2-3 agar cubes) of the content onto a plate or broth with medium recommended.
Incubate the inoculum/strain at the temperature and conditions recommended. Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 3-6 days of incubation. However, the time necessary for significant growth will vary from strain to strain.
Handling notes
Control strain for identification.
Additional, updated information on this product may be available on the ATCC® web site at www.atcc.org.
Quality control specifications
Sequenced data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
TGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTC
D1D2 region of the 28S ribosomal RNA gene
CCTCCCCCGGGGGCCCGAGTTGTAATTTGCAGAGGATGTTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGTATTCCTCGTTTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGAC
Verification method
Whole-genome Sequencing
History
Deposited as
Trichophyton tonsurans Malmsten
Synonyms
Trichomyces tonsurans (Malmsten) Guéguen, Oidium tonsurans (Malmsten) Zopf, Oospora tonsurans (Malmsten) Saccardo et Traverso, Trichophyton equinum var. equinum, Trichophyton depilans Mégnin, Trichophyton acuminatum Bodin, Trichophyton crateriformis Saccardo, Trichophyton equinum Gedoelst, Trichophyton flavum Bodin, Trichophyton crateriforme Saccardo, Trichophyton fumatum Saccardo, Trichophyton regulare Saccardo, Trichophyton sulphureum Saccardo et Fox, Trichophyton sulfureum Saccardo et Fox, Trichophyton cerebriforme Saccardo, Trichophyton effractum Saccardo, Trichophyton exsiccatum Uriburu, Trichophyton plicatilis Saccardo, Trichophyton pilosum Saccardo, Trichophyton umbilicatum Saccardo, Trichophyton polygorum Uriburu, Trichophyton plicatile Saccardo, Trichophyton ochropyrraceum Muijs, Bodinia spadix Katoâ, Trichophyton crateriformis var. ochropyrraceum (Muijs) Keller, Trichophyton areolatum Negroni, Trichophyton floriforme Beintema, Trichophyton equinum var. autotrophicum Smith et al., Trichophyton tonsurans subvar. perforans Matsumoto et al.
Depositors
MP English
Type of isolate
Human
Patient gender
Male